View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8008_high_25 (Length: 344)
Name: NF8008_high_25
Description: NF8008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8008_high_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 1 - 328
Target Start/End: Complemental strand, 27379740 - 27379413
Alignment:
| Q |
1 |
acttgatttgagtggtaatttgctctctggtggaattcctcaatcaatgcaaagactcaattcttgtaactctctcagtttgcaaggaaactcattcaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27379740 |
acttgatttgagtggtaatttgctctctggtggaattcctcaatcaatgcaaagactcaattcttgtaactctctcagtttgcaaggaaactcattcaca |
27379641 |
T |
|
| Q |
101 |
ggtaacattcctgattggattggagagttgaaagatctagaaaatcttgatctttctgctaatagattttctggttggattccaaagtcattaggaaatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27379640 |
ggtaacattcctgattggattggagagttgaaagatctagaaaatcttgatctttctgctaatagattttctggttggattccaaagtcattaggaaatc |
27379541 |
T |
|
| Q |
201 |
ttgacatgctgcaaagattgaatttttctaggaatcagttaaccggaaacttgccggattcgatgatgaactgtactaagcttttggctcttgatattag |
300 |
Q |
| |
|
|| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
27379540 |
ttaacatgctgcaaagattgaatttttcaaggaatcagttaaccggaaacttgccggattcgatgatgaactgtactaagcttttggctcttgatatcag |
27379441 |
T |
|
| Q |
301 |
taacaatcaattgaatggttatcttcct |
328 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
27379440 |
taacaatcaattgaatggttatcttcct |
27379413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University