View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8008_high_33 (Length: 296)
Name: NF8008_high_33
Description: NF8008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8008_high_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 7e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 1006169 - 1006030
Alignment:
| Q |
1 |
tgctcttctaacctggatattcttgtttgttgattgtgttatgaacatcttcannnnnnnnnnaacttgatagtttggacttattgggcgtgattgatct |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1006169 |
tgctcttctaacctg-atattcttgtttgttgattgtgttatgaacatcttcattttttttt-aacttgatagtttggacttattgggcgtgattgatct |
1006072 |
T |
 |
| Q |
101 |
tgatggagacgatacatctaccactagaagacccaaaattga |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1006071 |
tgatggagacgatacatctaccactagaagacccaaaattga |
1006030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 207 - 287
Target Start/End: Complemental strand, 1005965 - 1005884
Alignment:
| Q |
207 |
aggatgcatgaatcttcagcgatttatttcagagaattgatttaac-tttgtttttgcactttttatctattaaatttgcat |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1005965 |
aggatgcatgaatcttcagcgatttatttcagagaattgatttaacttttgtttttgcactttttatctattaaatttgcat |
1005884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University