View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8008_high_44 (Length: 250)
Name: NF8008_high_44
Description: NF8008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8008_high_44 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 183 - 250
Target Start/End: Original strand, 6266076 - 6266143
Alignment:
| Q |
183 |
atatctagaacaacttagtttgattgttataatgaagaatttggtttattgttctctcattaatttct |
250 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6266076 |
atatctagaagaacttagtttgattgttatgatgaagaatttggtttattgttctctcattgatttct |
6266143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 116 - 148
Target Start/End: Complemental strand, 2600895 - 2600863
Alignment:
| Q |
116 |
gtagatggatgagattaaagacttaagatcttg |
148 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
2600895 |
gtagatggatgagattaaagacttaggatcttg |
2600863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University