View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8008_high_44 (Length: 250)

Name: NF8008_high_44
Description: NF8008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8008_high_44
NF8008_high_44
[»] chr1 (1 HSPs)
chr1 (183-250)||(6266076-6266143)
[»] chr3 (1 HSPs)
chr3 (116-148)||(2600863-2600895)


Alignment Details
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 183 - 250
Target Start/End: Original strand, 6266076 - 6266143
Alignment:
183 atatctagaacaacttagtttgattgttataatgaagaatttggtttattgttctctcattaatttct 250  Q
    |||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||    
6266076 atatctagaagaacttagtttgattgttatgatgaagaatttggtttattgttctctcattgatttct 6266143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 116 - 148
Target Start/End: Complemental strand, 2600895 - 2600863
Alignment:
116 gtagatggatgagattaaagacttaagatcttg 148  Q
    ||||||||||||||||||||||||| |||||||    
2600895 gtagatggatgagattaaagacttaggatcttg 2600863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University