View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8008_high_47 (Length: 241)
Name: NF8008_high_47
Description: NF8008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8008_high_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 225
Target Start/End: Original strand, 40518426 - 40518633
Alignment:
| Q |
18 |
atgtgaagtattccgtaaaaagtgtgtacatgctctgtatggagggtttggtggacatatctcatcttcaaaggccatgcttcttgtccgacattttgca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
40518426 |
atgtgaagtattccgtaaaaagtgtgtacatgctctgtatggagggtttggtggacatatctcatcttcaaaggccatgcttctggtccgacatttggca |
40518525 |
T |
|
| Q |
118 |
tttaaacatcccttcgaaattaaaaaatttagtttggcaaatgtgtcgtcgttgtttgcccacacgagtttacttgtaggataaatgtattcaataccct |
217 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40518526 |
tttaaacatccctccgaaattaaaaaatttagtttggcaaatgtgtcgtcgttgtttgcccacacgagtttgcttgtaggataaatgtattcaataccct |
40518625 |
T |
|
| Q |
218 |
acaaattg |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
40518626 |
acaaattg |
40518633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 101
Target Start/End: Original strand, 41837233 - 41837290
Alignment:
| Q |
44 |
tacatgctctgtatggagggtttggtggacatatctcatcttcaaaggccatgcttct |
101 |
Q |
| |
|
|||||||| |||||||||||||||| ||||| |||||||||||||||| | |||||| |
|
|
| T |
41837233 |
tacatgctttgtatggagggtttggcggacacctctcatcttcaaaggctaggcttct |
41837290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University