View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8008_low_24 (Length: 349)
Name: NF8008_low_24
Description: NF8008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8008_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 28381775 - 28381472
Alignment:
| Q |
1 |
tggtgacggatggaattgatcgtgggagatggctgcttccggtgaaatattttgaatataaaggcattcattcattattcnnnnnnntatatcattcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28381775 |
tggtgacggatggaattgatcgtgggagatggctgcttccggtgaaatatcttgaatataaaggcattcattcattattcaaaaaaagatatcattcatt |
28381676 |
T |
 |
| Q |
101 |
taattttctgttttgaaaatagtgctgcttgaaatggtttannnnnnnnnnnnnggtatgatatggaatattggtgttaaagaacattgttttgattctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28381675 |
taattttctgttttgaaaatagtgctgcttgaaatggttt-tttttggttttttggtatgatatggaatattggtgttaaagaacattgttttgattctt |
28381577 |
T |
 |
| Q |
201 |
gttgatagatgaatattcggaaggattttgaaatggnnnnnnnnnnnnnnnaagtgtagttaacgagattatggattctgattgattggtatattggttt |
300 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28381576 |
gttgatagatggatattcggaaggattttgaaatgg--ttttttactttttaagtgtagttaacgagattatggattctgattgattggtatattggttt |
28381479 |
T |
 |
| Q |
301 |
tcatttt |
307 |
Q |
| |
|
||||||| |
|
|
| T |
28381478 |
tcatttt |
28381472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 187 - 236
Target Start/End: Original strand, 33001212 - 33001261
Alignment:
| Q |
187 |
ttgttttgattcttgttgatagatgaatattcggaaggattttgaaatgg |
236 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||| |||||||| |
|
|
| T |
33001212 |
ttgttttgattcttgttgatagatgcatattcgaaaggattctgaaatgg |
33001261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 252 - 287
Target Start/End: Original strand, 33001268 - 33001303
Alignment:
| Q |
252 |
aagtgtagttaacgagattatggattctgattgatt |
287 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33001268 |
aagtgtagttaacaagattatggattctgattgatt |
33001303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University