View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8008_low_38 (Length: 277)
Name: NF8008_low_38
Description: NF8008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8008_low_38 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 14 - 262
Target Start/End: Original strand, 11425001 - 11425251
Alignment:
| Q |
14 |
agatcaaaataattggttttaa-tagtatttcatgaactttttactcatttacaaaattatttat--ttcaaatgagttgtaagtccatccagtagtaaa |
110 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11425001 |
agatcaaaataattggttttaaatagtatttcatgaactttttactcatttacaaaattatttatatttcaaatgagttgtaagtccatccagtagtaaa |
11425100 |
T |
|
| Q |
111 |
caagcatatgaaagcttaccaatcaatcaaaatgaaaattcaactcatgttccaagtnnnnnnntactaatgcactttttctccccaagtctgtctacaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11425101 |
caagcatatgaaagcttaccaatcaatcaaaatgaaaattcaactcatgttctaagt-cccccctactaatgcactttttctccccaagtctgtctacaa |
11425199 |
T |
|
| Q |
211 |
aaacaatgtagatttcattgactgattcttttgtgattttgttgaacttact |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11425200 |
aaacaatgtagatttcattgactgattcttttgtgattttgttgaacttact |
11425251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University