View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8008_low_39 (Length: 275)
Name: NF8008_low_39
Description: NF8008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8008_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 11 - 257
Target Start/End: Original strand, 42089305 - 42089551
Alignment:
| Q |
11 |
tatattattctataatgcgtgggtgagtgatctcaaagaaacataactgagacggcacggcacacattgggaagatttcagttggagcataataattaaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42089305 |
tatattattctataatgcgtgggtgagtgatctcaaagaaacataactgggacggcacggcacacattgggaagatttcagttggagcataataattaaa |
42089404 |
T |
 |
| Q |
111 |
tatatatgatgagtttggaaaattagctttgaagattaataaaatacattttgtgcattcacgtggtcataataaacctgttggttatgaattatgcaca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42089405 |
tatatatgatgagtttggaaaattagctttgaagattaataaaatacattttgtgcattcacgtgatcataataaacctgttggttatgaattatgcaca |
42089504 |
T |
 |
| Q |
211 |
tgaagacttcatcttttttcgggttcatatcatatgatatacttttt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42089505 |
tgaagacttcatcttttttcgggttcatatcatatgatatacttttt |
42089551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University