View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8008_low_41 (Length: 273)
Name: NF8008_low_41
Description: NF8008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8008_low_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 19 - 257
Target Start/End: Complemental strand, 32093915 - 32093677
Alignment:
| Q |
19 |
ttatgtgtcttttggtcacactatttcctctgactttctttaatatatatttttggaaagtcaacagcttgttatttaggtgatcggttttaaaatatgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32093915 |
ttatgtgtcttttggtcacactatttcctctgactttctttaatatatatttttggaaagtcaacagcttgttatttaggtgatcggttttaaaatatgt |
32093816 |
T |
|
| Q |
119 |
agcttatcatcccaacttgtcaaaaggagaaaagtgcagaaaaggatgcaataatctaaggggtaaaatataaaagatgtgtatgattgttatctaggtc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32093815 |
agcttatcatcccaacttgtcaaaaggagaaaagtgcagaaaaggatgcaataatctaaggggtaaaatataaaagatgtgtatgattgttatctaggtc |
32093716 |
T |
|
| Q |
219 |
ttatattgtgtaccaataagtggaagctcgttacaagta |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32093715 |
ttatattgtgtaccaataagtggaagctcgttacaagta |
32093677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University