View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8008_low_43 (Length: 254)
Name: NF8008_low_43
Description: NF8008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8008_low_43 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 2448363 - 2448126
Alignment:
| Q |
1 |
atacaaaaagttgaattaccaacataaaccagagatagaaa-gttgaatccagtctgcagttatagactgacttcatgttttttccgtctctaattttcc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2448363 |
atacaaaaagttgaattaccaacataaaccagagatagaaaagttgaatccagtctgcagttatagactgacttcatgttttttccgtctctaattttcc |
2448264 |
T |
 |
| Q |
100 |
gtcgctgatgccannnnnnnaaatactatgaatgaaataaatggaatgagataggagataaaaaggtatacttactttccaccaaatgtcatcaattgta |
199 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2448263 |
gtcgctgatgcaatttttttaaatactatgaatgaaataaatggaatgagataggagataaaaaggtatacttactttccaccaaatgtcatcaattgta |
2448164 |
T |
 |
| Q |
200 |
caactgcaaatacagtaccacctttagcaccatgatac |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2448163 |
caactgcaaatacagtaccacctttagcaccatgatac |
2448126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 200 - 237
Target Start/End: Complemental strand, 2619308 - 2619271
Alignment:
| Q |
200 |
caactgcaaatacagtaccacctttagcaccatgatac |
237 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2619308 |
caacagcaaatacagtaccacctttagcaccatgatac |
2619271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 200 - 237
Target Start/End: Original strand, 2678077 - 2678114
Alignment:
| Q |
200 |
caactgcaaatacagtaccacctttagcaccatgatac |
237 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2678077 |
caacagcaaatacagtaccacctttagcaccatgatac |
2678114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University