View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8008_low_45 (Length: 251)
Name: NF8008_low_45
Description: NF8008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8008_low_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 49055854 - 49056096
Alignment:
| Q |
1 |
tggaggccaactgtgttttatgtcatgcgtaagatgattgattttggtcgctgattagcattttatgatcgagacaactgtattactaattttaacaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49055854 |
tggaggccaactgtgttttatgtcatgcgtaagatgattgattttggtcgctgattagcattttatgatcgagacaactgtattactaattttaacaaga |
49055953 |
T |
 |
| Q |
101 |
cactaaatttccatgtctgctaaaatgagttgttcgcatttttcttctttttgtcttgcaagttggtaacaacccatc-----atcttattttgcagctg |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49055954 |
cactaaatttccatgtctgctaaaatgagttgttcgcatttttcttctttttgtcttgcaagttggtaacaacccatcatctaatcttattttgcagctg |
49056053 |
T |
 |
| Q |
196 |
gtagggatcccatctcttcactgaagaaatacattattgagaa |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
49056054 |
gtagggatcccatctcttcactgaagtaatacattattgagaa |
49056096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University