View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8008_low_51 (Length: 237)
Name: NF8008_low_51
Description: NF8008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8008_low_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 16 - 141
Target Start/End: Complemental strand, 6675975 - 6675850
Alignment:
| Q |
16 |
agacatgtctcagaaactttcaatgcttgatgacttagttcatagcttggaagaagaaatgaagaaagttcttgctttcaaacgtgaactccctctttcc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6675975 |
agacatgtctcagaaactttcaatgcttgatgacttagttcatagcttggaagaagaaatgaagaaagttcttgctttcaaacgtgaactccctctttcc |
6675876 |
T |
 |
| Q |
116 |
atactcctccttaatgatggtaatta |
141 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
6675875 |
atactcctccttaatgatggtaatta |
6675850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University