View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8008_low_53 (Length: 232)
Name: NF8008_low_53
Description: NF8008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8008_low_53 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 28 - 215
Target Start/End: Complemental strand, 44703058 - 44702871
Alignment:
| Q |
28 |
ctcttatgatccttacttacccccaataggttaatagataaaaaattatcttcctttcctttcttgcaagtgattcgatgccnnnnnnnccttggcaaga |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
44703058 |
ctcttatgatccttacttacccccaataggttaatagatcaaaaattatcttcctttccttgcttgcaagtgattcgatgcctttttttccttggcaaga |
44702959 |
T |
 |
| Q |
128 |
ataaggaacccttttccttaacnnnnnnngatatgacatcccttttccttgaagagcgccactttatttttccaccttactccatgat |
215 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44702958 |
ataagcaacccttttccttaacaaaaaaagatatgacatcccttttccttgaagagcgccactttatttttccaccttactccatgat |
44702871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University