View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8008_low_57 (Length: 226)
Name: NF8008_low_57
Description: NF8008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8008_low_57 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 17 - 190
Target Start/End: Complemental strand, 33502044 - 33501867
Alignment:
| Q |
17 |
cagagacgctagtttttcttgactttcgagaattggttttctactttgtctctaactgtcttgagtgtttcttgtacctaagttattcc----ttttcaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33502044 |
cagagacgctagtttttcttgactttcgagaattggttttctactttgtctctaactgtcttgagtgtttcttgtacctaagttattcctttattttcaa |
33501945 |
T |
|
| Q |
113 |
caaagttattttacgtataaaataagttacaattgcatttttaaccaattcaccccttcttaattgtatccctatgtt |
190 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33501944 |
caaagtaattttacgtataaaataagttacaattgcatttttaaccaattcaccccttcttaattgtatccctatgtt |
33501867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University