View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8008_low_59 (Length: 213)
Name: NF8008_low_59
Description: NF8008
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8008_low_59 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 10670902 - 10671113
Alignment:
| Q |
1 |
ctagttgaaaactcatgtgactcctgtattaaaccatattgttgacgatctaataggcattatccaacttcaaaattgagctttgaaagtatatgtaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
10670902 |
ctagttgaaaactcatgtgactcatgtattaaaccatattgttgacgatctaataggcattatccaacttcgaaattgagcattgaaagtatatgtaaaa |
10671001 |
T |
|
| Q |
101 |
caaatatgttgatctatcctctnnnnnnnnntgttgatctatgtaatctacaacataccaaacaacatgattaaaatcattcattcatttaaaaatacaa |
200 |
Q |
| |
|
|| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10671002 |
catatatgttgatctatcctct-aaaaaaaatgttgatctatgtaatctacaacataccaaacaacatgattaaaatccttcattcatttaaaaatacaa |
10671100 |
T |
|
| Q |
201 |
acttgcagccaaa |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
10671101 |
acttgcagccaaa |
10671113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University