View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8009_high_5 (Length: 348)
Name: NF8009_high_5
Description: NF8009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8009_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 341
Target Start/End: Complemental strand, 1762053 - 1761705
Alignment:
| Q |
1 |
tcccatgatcttagcattatattcgtggagtcgactatcataccgacctttgtcttcaacgtgattnnnnnnnnnnnnncattgttattcaaaatcaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1762053 |
tcccatgatcttagcattatattcgtggagtcgactatcataccgacctttgtcttcaacgtgattaaaataaaaaa--cattgttattcaaaatcaaca |
1761956 |
T |
|
| Q |
101 |
tttacaagcaattgtatgtaaaaacaacatctttactattgcatatacatgcctatcattgtaaaatagtttccaatgtcaaaaatactccaacatatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1761955 |
tttacaagcaattgtatgtaaaaacaacatctttactattgcatatacatgcctatcattgtaaaatagtttccaatgtcaaaaatactccaacatatta |
1761856 |
T |
|
| Q |
201 |
ac---------nnnnnnnnnnatttaaatatgcttttaagtccttacaaatatgctattttgtgcttttaattagtccttaaaaatatatttctagtcct |
291 |
Q |
| |
|
|| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1761855 |
actctttttttttttttatttatttaaatgtgcttttaagtccttacaaatatgctattttatgcttttaattagtccttaaaaatatatttctagtcct |
1761756 |
T |
|
| Q |
292 |
tgcgtgt-atatcactttttgctttaagttgatccttgatatattcttcga |
341 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||| ||| || ||||| |
|
|
| T |
1761755 |
tgcgtgtaatatcactttttgctttaagttggtccttggtattttgttcga |
1761705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University