View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8009_high_8 (Length: 273)
Name: NF8009_high_8
Description: NF8009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8009_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 17 - 257
Target Start/End: Complemental strand, 35350652 - 35350402
Alignment:
| Q |
17 |
acatcaagcttctacgacttcacgtgcaaaatgggctggtgcccctacaaacatgtacccac----------ccctgattactctgtttttatttacaac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |||| |
|
|
| T |
35350652 |
acatcaagcttctacgacttcacgtgcaaaatgggctggtgcccctacaaacatgtacccacgtctgcccgcccctgattactctatttttatttccaac |
35350553 |
T |
 |
| Q |
107 |
tatgaattgatcatgtgnnnnnnntttaattgtgggatttcacagctcacgattaattttgttaggaattggtctaagtcattttgtgatttgaaagtga |
206 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35350552 |
tatgaattgatcatgtgaaaaaaatttaattgtgggatttcacagctcacgattaattttgttaggaattggtctaagtcattttgtgatttgaaagtga |
35350453 |
T |
 |
| Q |
207 |
tcgatggtttatccttggtccaagattttgaaattgtctcattctaatttg |
257 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35350452 |
tcgatggtttaaccttggtccaagattttgaaattgtctcattctaatttg |
35350402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University