View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8009_low_13 (Length: 240)
Name: NF8009_low_13
Description: NF8009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8009_low_13 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 240
Target Start/End: Original strand, 43133153 - 43133378
Alignment:
| Q |
18 |
tgatcgacgaatgaggttggatcgtgtgaaagggaaaatgatttgatttctatgccaaa--ccaaattttgaatatgttagaagcgctattcacattttg |
115 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43133153 |
tgatcgacgaatgaggttgggtcgtgtgatagggaaaatgatttgatttctatgccaaaaaccaaattttgaatatgttagaagcgctattcacattttg |
43133252 |
T |
 |
| Q |
116 |
tgtctagaggtatctaaaataaataggtttacttaaa-gagaataaaatctaaaggaatgataaataacacatttttaatcaataattcatgtcttttta |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43133253 |
tgtctagaggtatctaaaataaataggtttacttaaaagagaataaaatctaaaggaatgataaataacacatttttaatcaataattcatgtcttttta |
43133352 |
T |
 |
| Q |
215 |
gtgtcacggtgtcaacacaacaattt |
240 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
43133353 |
gtgtcacggtgtcaacacaacaattt |
43133378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University