View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8009_low_4 (Length: 390)
Name: NF8009_low_4
Description: NF8009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8009_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 18 - 252
Target Start/End: Complemental strand, 36602355 - 36602121
Alignment:
| Q |
18 |
agttattgctcatgttgatcatcctaatactgcaaagcttgttggatgttgtgtagagggagaaatgcatcttgtcttcgaattgtctacactgggaagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36602355 |
agttattgctcatgttgatcatcctaataccgcaaagcttgttggatgttgtgtagagggagaaatgcatcttgtcttcgaattgtctacactgggaagt |
36602256 |
T |
 |
| Q |
118 |
ttaggatatgttcttcatggtttgtagatactttgaactctctcatgatgacaatcacttttgaacttattttgtttttatatcaaatggaatgaaactc |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
36602255 |
ttaggatacgttcttcatggtttgtagatactttgaactctctcatgatgacaatcacttttaaacttattttgttttcatatcaaatggaatcaaactc |
36602156 |
T |
 |
| Q |
218 |
aatactcgagggtttacaaccctcgcacacatatt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
36602155 |
aatactcgagggtttacaaccctcgcacacatatt |
36602121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 253 - 371
Target Start/End: Complemental strand, 36602086 - 36601968
Alignment:
| Q |
253 |
aacatgctttcaactttaaatgtacttatagcttattccctcatgatgtatttcaggttcagataaaaccaaattggattggagtaaaaggtataaagtt |
352 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36602086 |
aacatactttcaactttaaatgtacttatagcttattccctcatgatgtatttcaggttcagataaaaccaaattggattggagtaaaaggtataaagtt |
36601987 |
T |
 |
| Q |
353 |
gctcttggaattgctgatg |
371 |
Q |
| |
|
||||| ||||||||||||| |
|
|
| T |
36601986 |
gctctcggaattgctgatg |
36601968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University