View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8009_low_8 (Length: 317)
Name: NF8009_low_8
Description: NF8009
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8009_low_8 |
 | |
|
| [»] scaffold1717 (1 HSPs) |
| | |
|
| [»] scaffold1527 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 105 - 302
Target Start/End: Complemental strand, 37757501 - 37757304
Alignment:
| Q |
105 |
gattatgggaagccgtggattcggtgcgacgaagagaagttctaatgggaagcttggaagtgtgagtgattattgtgttcgtcattgtgtttgtcctgtt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37757501 |
gattatgggaagccgtggattcggtgcgacgaagagaagttctaatgggaagcttggaagtgtgagtgattattgtgttcgtcattgtgtttgtcctgtt |
37757402 |
T |
|
| Q |
205 |
gtagttgtaaggtatccggaggagagtaatggcggcggcgccggagttgaagggaatgatggtgaaaaagttgaacttcatcctgttattgaggaaga |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37757401 |
gtagttgtaaggtatccggaggagagtaatggcggtggcgccggagttgaagggaatgatggtgaaaaagttgaacttcatcctgttattgaggaaga |
37757304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 9 - 66
Target Start/End: Complemental strand, 39326783 - 39326726
Alignment:
| Q |
9 |
tatattattctatacaagaagaaggtaaaaaagaaaaggttaatttgagatcaaggac |
66 |
Q |
| |
|
|||| |||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39326783 |
tatagtattttatacaagaagaaggaaaaaaagaaaaggttaatttgagatcaaggac |
39326726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1717 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold1717
Description:
Target: scaffold1717; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 149 - 212
Target Start/End: Complemental strand, 460 - 397
Alignment:
| Q |
149 |
atgggaagcttggaagtgtgagtgattattgtgttcgtcattgtgtttgtcctgttgtagttgt |
212 |
Q |
| |
|
||||||||||||| ||||| |||||||| ||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
460 |
atgggaagcttgggagtgttagtgattactgtgtgcatcattgtgtttgtcctgttgttgttgt |
397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1527 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold1527
Description:
Target: scaffold1527; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 149 - 212
Target Start/End: Complemental strand, 706 - 643
Alignment:
| Q |
149 |
atgggaagcttggaagtgtgagtgattattgtgttcgtcattgtgtttgtcctgttgtagttgt |
212 |
Q |
| |
|
||||||||||||| ||||| |||||||| ||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
706 |
atgggaagcttgggagtgttagtgattactgtgtgcatcattgtgtttgtcctgttgttgttgt |
643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University