View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8010_high_3 (Length: 417)
Name: NF8010_high_3
Description: NF8010
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8010_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 361; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 7 - 403
Target Start/End: Original strand, 19171141 - 19171537
Alignment:
| Q |
7 |
tggacatcagcaataataggagcagcatcagcagtagcagcaacatcaattctctcagcaaaaccaaaagacccaacattccatctcatctccatcaact |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19171141 |
tggacatcagcaataataggagcagcatcagcagtagcagcaacatcaattctctcagcaaaaccaaaagacccaacatttcatctcatctccatcaact |
19171240 |
T |
|
| Q |
107 |
tcacctccttaaaaccaagcctccccgttgtagacgcagaagttcttctaactgtccatgtcaccaatccaaacatagccccaattaactactcatcaac |
206 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||| |||| |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19171241 |
tcacttccttaaaaccaagcctccccgtcgtagacgcagaagttcttttaaccgtccatgtcaccaatccaaacatagctccaattaactactcatcaac |
19171340 |
T |
|
| Q |
207 |
aaccatgtcaattttctacgaaggttctctcctcggttcagctccggtccaagccgggtctcagccaccgaggtcatgtcagttactgagacttccggct |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
19171341 |
aaccatgtcaattttctacgaaggttctctcctcggttcagctccggtccaagccgggtctcagccaccgaggtcatgtcagttactgagacttcctgcc |
19171440 |
T |
|
| Q |
307 |
cggcttaaagctcttcggctcgcgaaacacgcgagccgagtaatgtctgacgtggcgaaaagggagatggttcttgatgcggctgttgatattgctg |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19171441 |
cggcttaaagctcttcggctcgcgaaacacgcgagccgagtaatgtctgacgtggcgaaaagggagatggttcttgatgcagctgttgatattgctg |
19171537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University