View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8011_high_5 (Length: 229)
Name: NF8011_high_5
Description: NF8011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8011_high_5 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 37446320 - 37446092
Alignment:
| Q |
1 |
tcatgagcctcttaccaggcatacaagtgaatcttctgtctatgcaactgaagaggaagaagatgaatatggagcaaaaatacagctaggtcctatgtgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37446320 |
tcatgagcctcttaccaggcatacaagtgaatcttctgtctatgcaactgaagaggaagaagatgaatatggagcaaaaatacagctaggtcctatgtgc |
37446221 |
T |
|
| Q |
101 |
actactaaagaacaccttgagaaagataaggttttgtttcttgtggaactacacatttttcttgttcatatttgaatcaatctagtccttcacattatca |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37446220 |
actattaaagaacaccttgagaaagataaggttttgtttcttgtggaactacacattttttttgttcatatttgaatcaatctagtccttcacattatca |
37446121 |
T |
|
| Q |
201 |
atattctagaatggtatctgaaaatataa |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37446120 |
atattctagaatggtatctgaaaatataa |
37446092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 176 - 205
Target Start/End: Original strand, 27141016 - 27141045
Alignment:
| Q |
176 |
atcaatctagtccttcacattatcaatatt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27141016 |
atcaatctagtccttcacattatcaatatt |
27141045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University