View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8011_low_11 (Length: 269)
Name: NF8011_low_11
Description: NF8011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8011_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 103 - 257
Target Start/End: Complemental strand, 29229444 - 29229290
Alignment:
| Q |
103 |
agaaagagagatgaatataatataagtgactgagctttcacatcatggctttgttaagggccctaagaagggaggggtgacaatgtccttgacgaaagtg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29229444 |
agaaagagagatgaatataatataagtgactgagctttcacatcatggctttgttaagggccctaagaagggaggggtgacaatgtccttgacgaaagtg |
29229345 |
T |
|
| Q |
203 |
gctgactctattgtctgccccgtatttaaagcgcgctctgtttctgtgatgtcca |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29229344 |
gctgactctattgtctgccccgtatttaaagcgcgctctgtttctgtaatgtcca |
29229290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University