View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8011_low_12 (Length: 251)
Name: NF8011_low_12
Description: NF8011
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8011_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 59; Significance: 4e-25; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 56 - 114
Target Start/End: Complemental strand, 1376887 - 1376829
Alignment:
| Q |
56 |
gttatttaaatattcaattcaactaattttagaaagaggactacttacatgtgtttatt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1376887 |
gttatttaaatattcaattcaactaattttagaaagaggactacttacatgtgtttatt |
1376829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 136 - 189
Target Start/End: Complemental strand, 1376800 - 1376747
Alignment:
| Q |
136 |
gagagaagaaagagtcttcttcaagacttaactcacttgttacgccgttacgcg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1376800 |
gagagaagaaagagtcttcttcaagacttaactcacttgttacgccgttacgcg |
1376747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University