View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8012_high_10 (Length: 211)
Name: NF8012_high_10
Description: NF8012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8012_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 15 - 193
Target Start/End: Original strand, 29935118 - 29935296
Alignment:
| Q |
15 |
cagagagcactcttagaaacttgacagatctgaaagcaaacttgtccccaaatgttttgggtacatgatgcttggtcacatctattgacacatctgaact |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29935118 |
cagagagcactcttagaaacttgacagatctgaaagcaaacttgtccccaaatgtttttggtacatgatgcttggtcacatctattgacacatctgaact |
29935217 |
T |
 |
| Q |
115 |
gtaactttcccacggctgcgaacaaagatcgtatgagaaatcatcgaaatacaacagcatgcaagatcaagtaactcat |
193 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29935218 |
gtaactttcccacggctgcgaaaaaagatcgtatgagaaatcatccaaatacaacagcatgcaagatcaagtaactcat |
29935296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 15 - 133
Target Start/End: Original strand, 29932363 - 29932481
Alignment:
| Q |
15 |
cagagagcactcttagaaacttgacagatctgaaagcaaacttgtccccaaatgttttgggtacatgatgcttggtcacatctattgacacatctgaact |
114 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29932363 |
cagagagaacccttagaaacttgacagatctgaaagcaaacttgtccccaaatgtttttggtacatgatgcttggtcacatctattgacacatctgagct |
29932462 |
T |
 |
| Q |
115 |
gtaactttcccacggctgc |
133 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
29932463 |
gtaactttcccatggctgc |
29932481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University