View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8012_low_10 (Length: 282)
Name: NF8012_low_10
Description: NF8012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8012_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 8e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 16 - 139
Target Start/End: Original strand, 5115154 - 5115277
Alignment:
| Q |
16 |
ataatactttcttttgttggacggatgaagtaggcaacagtggttcttgcagtgcctgaatttgtcacaacacggtgctctgctcctatcagccttccat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5115154 |
ataatactttcttttgttggacggatgaagtaggcaacagtggttcttgcagtgcctgaatttgtcacaacacggtgctctgctcctatcagccttccat |
5115253 |
T |
|
| Q |
116 |
tactaatgatctacacattagtga |
139 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5115254 |
tactaatgatctacacattagtga |
5115277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University