View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8012_low_12 (Length: 249)
Name: NF8012_low_12
Description: NF8012
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8012_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 53 - 171
Target Start/End: Original strand, 8761225 - 8761341
Alignment:
| Q |
53 |
catatcaaacaaaatgatgctactgaaggcttgtaattgtaattgttttaagatatgttgattggagctagagattttcactttcatggatgtggctgat |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||| |||| |||||| ||||| || ||||| |||| ||||||||||||||| |
|
|
| T |
8761225 |
catatcaaacaaaatgatgctactgaaggcttgtaattacatgtgttttaaaatattttgattagagct-ga-attttggctttgatggatgtggctgat |
8761322 |
T |
|
| Q |
153 |
tttggaattgcaggaatgt |
171 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
8761323 |
tttggaattgcaggaatgt |
8761341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 8759888 - 8759945
Alignment:
| Q |
1 |
tgtttattgctttgttctttcactttgttctttgtgttctgtttaggagctccatatc |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||||||||| |||||| |
|
|
| T |
8759888 |
tgtttattgctttgttctttcactttgttctttgtgtcctatttaggagcttcatatc |
8759945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 166 - 201
Target Start/End: Original strand, 8761545 - 8761580
Alignment:
| Q |
166 |
gaatgtcacacttgagatctatgaatcaatgacatc |
201 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8761545 |
gaatgtcacacttgagatctatgaatctatgacatc |
8761580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University