View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8013_high_6 (Length: 205)
Name: NF8013_high_6
Description: NF8013
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8013_high_6 |
 |  |
|
| [»] scaffold0110 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0110 (Bit Score: 172; Significance: 1e-92; HSPs: 3)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 30190 - 30377
Alignment:
| Q |
1 |
cgtttttagattaagtatgtgtttggattagcagtgagtttgtcagagtcatgatgtgccatagtgatttcggcaaaaactacactttgccgcttcaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
30190 |
cgtttttagattaagtatgtgtttggattagcagtgagtttgtcagagtcatgatgtgccatagtgatttaggcaaaaactacactttgcagcttcaaca |
30289 |
T |
 |
| Q |
101 |
aagtcacatggtgcaactgtgatttcatcaaacttgatgtgattcttattatgcactaagtggtttatttaatttgttcttctgatgt |
188 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30290 |
aagtcacatggtgcaactgtgatttcgtcaaacttgatgtgattcttattatgcactaagtggtttattcaatttgttcttctgatgt |
30377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 35 - 160
Target Start/End: Original strand, 13398 - 13523
Alignment:
| Q |
35 |
tgagtttgtcagagtcatgatgtgccatagtgatttcggcaaaaactacactttgccgcttcaacaaagtcacatggtgcaactgtgatttcatcaaact |
134 |
Q |
| |
|
||||||||||| | ||| |||||||||||||||||||| ||||||||||| |||| ||||||||||| ||||| ||||||||||||||||| ||||||| |
|
|
| T |
13398 |
tgagtttgtcacaatcacgatgtgccatagtgatttcgccaaaaactacattttgaagcttcaacaaaatcacaaggtgcaactgtgatttcgtcaaact |
13497 |
T |
 |
| Q |
135 |
tgatgtgattcttattatgcactaag |
160 |
Q |
| |
|
||| ||||| | || |||||||||| |
|
|
| T |
13498 |
cgatttgattttcatcatgcactaag |
13523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110; HSP #3
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 35 - 160
Target Start/End: Original strand, 21135 - 21260
Alignment:
| Q |
35 |
tgagtttgtcagagtcatgatgtgccatagtgatttcggcaaaaactacactttgccgcttcaacaaagtcacatggtgcaactgtgatttcatcaaact |
134 |
Q |
| |
|
||||||||||| | ||| |||||||||||||||||||| ||||||||||| |||| ||||||||||| ||||| ||||||||||||||||| ||||||| |
|
|
| T |
21135 |
tgagtttgtcacaatcacgatgtgccatagtgatttcgccaaaaactacattttgaagcttcaacaaaatcacaaggtgcaactgtgatttcgtcaaact |
21234 |
T |
 |
| Q |
135 |
tgatgtgattcttattatgcactaag |
160 |
Q |
| |
|
||| ||||| | || |||||||||| |
|
|
| T |
21235 |
cgatttgattttcatcatgcactaag |
21260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University