View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8015_low_2 (Length: 344)
Name: NF8015_low_2
Description: NF8015
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8015_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 190 - 328
Target Start/End: Original strand, 33387228 - 33387368
Alignment:
| Q |
190 |
gttaatatgaaccgaatccaaactcaatcggtcaatgttcttcagtaataactaataatgtaaaattttcaagagaaagaagattctaattctaagttaa |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33387228 |
gttaatatgaaccgaatccaaactcaatcggtcaatgttcttcagtaataactaataatgtaaaattttcaagagaaagaagattctaattctaagttaa |
33387327 |
T |
 |
| Q |
290 |
c--nnnnnnnnngatgttatgctctaataaatagtacaagg |
328 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |
|
|
| T |
33387328 |
caaaaaaaaaaagatgttatgctctaataaatagtacaagg |
33387368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 33387048 - 33387090
Alignment:
| Q |
10 |
aagaacgtgcaatttttagtactatcatataattgaagagatg |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33387048 |
aagaacgtgcaatttttagtactatcatataattgaagagatg |
33387090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University