View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8016_low_7 (Length: 209)
Name: NF8016_low_7
Description: NF8016
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8016_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 19 - 192
Target Start/End: Original strand, 28330718 - 28330891
Alignment:
| Q |
19 |
atatgtttgatgaagcaataaagatactgtcaaaaatgnnnnnnnnnggttgtacccccaacaaggcaatctatgaagtaatcgtgtatgctctttttga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28330718 |
atatgtttgatgaagcaataaagatactgtcaaaaatgaaaaaaaaaggttgtacccccaacaaggcaatctatgaagtaatcgtgtatgctctttttga |
28330817 |
T |
 |
| Q |
119 |
aaacgatgagattgaaaaggctacaaaacttgtgtatgaaatgagccgtatggggttcctctagtaattggtct |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28330818 |
aaacgatgagattgaaaaggctacaaaacttgtgtatgaaatgagccgtatggggttcctctagtaattggtct |
28330891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University