View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8018_high_5 (Length: 422)
Name: NF8018_high_5
Description: NF8018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8018_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 43952339 - 43952553
Alignment:
| Q |
1 |
caaaaacccacaacctcaaattcgattaaccaaaatgctctctggctgcaaacatcctaaaacaccatctttttccttagataacggcagaaacatatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43952339 |
caaaaacccacaacctcaaattcgattaaccaaaatgctctctggctgcaaacatcctaaaacaccatctttttccttagataacggcagaaacatatca |
43952438 |
T |
|
| Q |
101 |
tcctctaacgccgttaacaacaataacaacaaaatcaatgatgctgcaacactagctgacgttgaccgttttctctttgagaatttcaagtctctatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43952439 |
tcctctaacgccgttaacaacaataacaacaaaatcaatgatgctgcaacactagctgacgttgaccgttttctctttgagaatttcaagtctctatatt |
43952538 |
T |
|
| Q |
201 |
tcaaagatgacgaag |
215 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
43952539 |
tcaaagatgatgaag |
43952553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 297 - 404
Target Start/End: Original strand, 43952632 - 43952739
Alignment:
| Q |
297 |
gtattggtggttcctggttgttggaatcaccgagattcattacaacaccacctcaagatctttgtggctcagcacgattcttcgtgaaaccaggtaactc |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43952632 |
gtattggtggttcctggttgttggaatcaccgagattcattacaacaccacctcaagatctttgtggctcagcacgattcttcgtgaaaccaggtaactc |
43952731 |
T |
|
| Q |
397 |
aggatcat |
404 |
Q |
| |
|
|||||||| |
|
|
| T |
43952732 |
aggatcat |
43952739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 149 - 211
Target Start/End: Complemental strand, 3236178 - 3236116
Alignment:
| Q |
149 |
acactagctgacgttgaccgttttctctttgagaatttcaagtctctatatttcaaagatgac |
211 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||| |||| || |||||||| |
|
|
| T |
3236178 |
acactagaagacgttgaccgttttctcttcgagaatttcaagtctttatacctcgaagatgac |
3236116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University