View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8018_high_9 (Length: 229)
Name: NF8018_high_9
Description: NF8018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8018_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 76 - 210
Target Start/End: Complemental strand, 30144688 - 30144554
Alignment:
| Q |
76 |
ttgaagaatgcaagtgattgagccaaacccttttcctgagaggaacattctcatcaaagaacctagcccataatcgactgtgcagtctttgctttccaac |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30144688 |
ttgaagaatgcaagtgattgagccaaacccttttcctgagaggaacattctcatcaaagaacctagcccataatcgactgtgcagtctttgctttccaac |
30144589 |
T |
 |
| Q |
176 |
tatagcatcattcttcgacgattcaccttcaggta |
210 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30144588 |
tatagcatcattcttggacgattcaccttcaggta |
30144554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University