View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8018_low_8 (Length: 352)
Name: NF8018_low_8
Description: NF8018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8018_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 18 - 350
Target Start/End: Original strand, 8458273 - 8458611
Alignment:
| Q |
18 |
gatggtggccttcaagatcagtcacatttgtagataatcatgatactggctcaactcaggttcttagttcactatttctcaaaataacacactgaaatac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8458273 |
gatggtggccttcaagatcagtcacatttgtagataatcatgatactggctcaactcaggtttttagttcactatttctcaaaataacacactgaaatac |
8458372 |
T |
 |
| Q |
118 |
atgctcaagtgggggtgtgtatggtcagcgcaaatttatatgcatttttcttatttcgtatggaaactacaagcctggttatggtataattgatttatgt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8458373 |
atgctcaagtgggggtgtgtatggtcagcgcaactttatatgcatttttcttatttcgtatggaaactacaagcctggttatggtataattgatttatgt |
8458472 |
T |
 |
| Q |
218 |
aaaattaattttgcatttggaaataaattttgctatgtgaattgaaatattaaggaatagaagggatatttaggtttaaaggttactgattaataagg-- |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8458473 |
aaaattaattttgcatttggaaataaattttgctatgtgaattgaaatattaaggaatagaagggatatttaggtttaaaggttactgattaataaggtg |
8458572 |
T |
 |
| Q |
316 |
----ttacccactgcgaatatgacatattcttcgacatc |
350 |
Q |
| |
|
||| |||||||||||||||||| |||||| ||||| |
|
|
| T |
8458573 |
ccttttaaccactgcgaatatgacattttcttctacatc |
8458611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University