View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8019_low_24 (Length: 237)
Name: NF8019_low_24
Description: NF8019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8019_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 1355068 - 1355271
Alignment:
| Q |
18 |
gttttaaatataaatacaaagaccnnnnnnngagtttaattcaattggcatgaacattacaaaatatatataggagtcgaggtacgaaccacaaacatct |
117 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1355068 |
gttttaaatataaatacaaagacgttttttttagcttaattcaattgacatggacattacaaaatatatataggagtcgaggtacgaaccacggacattc |
1355167 |
T |
 |
| Q |
118 |
cacttattcaccttgtcaaagtgaatttctagtagttagatcacttgagaaataaaaataaagacacatatttgatctaaatttagacgatatagatgta |
217 |
Q |
| |
|
||||||||||||||||| ||||||||||||| | ||||||||||| | || |||||||| | ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1355168 |
cacttattcaccttgtcgaagtgaatttctaatcattagatcacttaaaaattaaaaatacaaacacatatttggtctaaatttagacgatatagatgta |
1355267 |
T |
 |
| Q |
218 |
tatt |
221 |
Q |
| |
|
|||| |
|
|
| T |
1355268 |
tatt |
1355271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University