View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8019_low_27 (Length: 214)
Name: NF8019_low_27
Description: NF8019
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8019_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 2 - 94
Target Start/End: Complemental strand, 26748627 - 26748535
Alignment:
| Q |
2 |
atagatgatgtttgtcaacggccagtctcaacaaaactttagctatcaacgaatgtctatatatttgaaaggtgttgcagcaaatgtatgtag |
94 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26748627 |
atagatgatgtttgtcaatggccagtctcaacaaaactttagctatcaacgaatgtctatatatttgaagggtgttgcagcaaatgtatgtag |
26748535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 149 - 196
Target Start/End: Complemental strand, 26748527 - 26748480
Alignment:
| Q |
149 |
gttgagggaaagattggtatgttaagtgtgaagaagagtctcatattc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26748527 |
gttgagggaaagattggtatgttaagtgtgaagaagagtcttatattc |
26748480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University