View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8020_high_47 (Length: 219)
Name: NF8020_high_47
Description: NF8020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8020_high_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 9 - 203
Target Start/End: Original strand, 4368108 - 4368302
Alignment:
| Q |
9 |
gttccaagagcaatcaagtagagtgctataaaaagggccgcagtttgtcctgacgtcggatggcagccactagtatcacatgaaggctttagtccaggtg |
108 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
4368108 |
gttccaagcgcaatcaagtagagtgctataaaaagggctgcagtttgtcctgacgtcggatggcacccatcagtatcacatgaaggctttagtccaggtg |
4368207 |
T |
 |
| Q |
109 |
caatagcagaaaatgttaaaagccccattccctgcaaagcacacaaacaacgactccattaacatgtctttcccttagacattttgattatgaac |
203 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4368208 |
caatagcggaaaatgttaaaagccccattccctgcaaagcacacaaacaatgactccattaacatgtctttccctcagacattttgattatgaac |
4368302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 24497858 - 24498001
Alignment:
| Q |
1 |
taccaccagttccaagagcaatcaagtagagtgctataaaaagggccgcagtttgtcctgacgtcggatggcagccactagtatcacatgaaggctttag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| | | || |||||||| | || || |||||||| || || ||||||||| ||||| || |
|
|
| T |
24497858 |
taccaccagttccaagagcaatcaagtagagggctatgtacattgctgcagtttgcgccgatgttggatggcacacattaccatcacatgatggcttaag |
24497957 |
T |
 |
| Q |
101 |
tccaggtgcaatagcagaaaatgttaaaagccccattccctgca |
144 |
Q |
| |
|
||||||| || ||||||| ||||||| ||| |||||||||||| |
|
|
| T |
24497958 |
tccaggtacagtagcagacaatgttagaagtaccattccctgca |
24498001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University