View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8020_low_27 (Length: 352)
Name: NF8020_low_27
Description: NF8020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8020_low_27 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 331; Significance: 0; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 14 - 352
Target Start/End: Original strand, 34216213 - 34216551
Alignment:
| Q |
14 |
tcatcgtatgctactgcagtaaccaaatccaacacggggctagtgagctgaggcaaccttccctttggaatttcatctataacatattgcaaggcaaggt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34216213 |
tcatcgtatgctactgcagtaaccaaatccaacacggggctagtgagctgaggcaaccttccctttggaatttcatctataacatattgcaaggcaaggt |
34216312 |
T |
 |
| Q |
114 |
tgaacgaattggtggaaacatccgtttgtgatttactgagttgggcaagcgagggactcatctccgtaacagaagcagaaacagtaaactcagagttctc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34216313 |
tgaacgaattggtggaaacatccgtttgtgatttactgagttgggcaagcgagggactcatctccttaacagaagcagaaacagtaaactcagagttctc |
34216412 |
T |
 |
| Q |
214 |
atgcacgttgacgtgctcaactgaagaggggagccgaacagcagcgacagaagtcccaagaactcttacgttccgagaatcctgtggcattttctctact |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34216413 |
atgcacgttgacgtgctcaactgaagaggggagccgaacggcagcgacagaagtcccaagaactcttacgttccgagaatcctgtggcattttctctact |
34216512 |
T |
 |
| Q |
314 |
ccctgtgaatgcacgtcatcgtgtgctacctcggaaacc |
352 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34216513 |
ccctgtgaatgcacgtcatcgtgtgctacctcggaaacc |
34216551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 155 - 268
Target Start/End: Original strand, 34216038 - 34216151
Alignment:
| Q |
155 |
tgggcaagcgagggactcatctccgtaacagaagcagaaacagtaaactcagagttctcatgcacgttgacgtgctcaactgaagaggggagccgaacag |
254 |
Q |
| |
|
||||| |||||||||||||||| | |||||||||| || | || ||||| | ||||||||||||| |||||||| | |||| ||| ||| |||||| |
|
|
| T |
34216038 |
tgggccagcgagggactcatctacctaacagaagcggagagagctaactcggcattctcatgcacgtcaacgtgctctattgaaaaggtaagcggaacag |
34216137 |
T |
 |
| Q |
255 |
cagcgacagaagtc |
268 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
34216138 |
cagctacagaagtc |
34216151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University