View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8020_low_43 (Length: 241)
Name: NF8020_low_43
Description: NF8020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8020_low_43 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 17 - 226
Target Start/End: Original strand, 11395704 - 11395914
Alignment:
| Q |
17 |
agaaatgaagttagatatcgcgatgaactgtgatatgcnnnnnnnn-cattctacggagttttaaatttctgtaattcaatgaatcttacttannnnnnn |
115 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11395704 |
agaaatgaagttagatatcgcaatgaactgtgatatgctttttttttcattctacggagttttaaatttctgtaattcaatgaatattacttattttttt |
11395803 |
T |
 |
| Q |
116 |
gtgtggaatttgtgataggaagatgaacaatgcatccaatggatttcaagcctcgcaacatcgatcgcaaccatcgcatcgagatatagagtgagaaaca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11395804 |
gtgtggaatttgtgataggaagatgaacaatgcatccaatggatttcaagcctcgcaacatcgatcgcaaccgtcgcatcgagatatagagtgagaaaca |
11395903 |
T |
 |
| Q |
216 |
gcgtatttgat |
226 |
Q |
| |
|
|| |||||||| |
|
|
| T |
11395904 |
gcatatttgat |
11395914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University