View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8020_low_45 (Length: 239)
Name: NF8020_low_45
Description: NF8020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8020_low_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 45973579 - 45973796
Alignment:
| Q |
1 |
ttgtcgactccgacaaaactcgtctgagcaccatcgcaggttgcctcaactacgaaacaacacatgccctttaccattttcgatctttgtcgtaaagtca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45973579 |
ttgtcgactccgacaaaactcgtctgagcaccatcgcaggttgcctcaactacgaaacaacacatgccctttaccattttcgatctttgtcgtaaagtca |
45973678 |
T |
 |
| Q |
101 |
ttgaataattaaccttctggatcgtattgtctccgtctgggttgcagacttgataagtcgctgtctttatcaaagcttgatgaatcaacccatttatgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45973679 |
ttgaataattaaccttctggatcgtattgtctccgtctgggttgcagacttgataagtcgctgtctttatcaaagcttgatgaatcaacccatttatgtt |
45973778 |
T |
 |
| Q |
201 |
taaagacattcatcgtgtt |
219 |
Q |
| |
|
| ||||||||||||||||| |
|
|
| T |
45973779 |
t-aagacattcatcgtgtt |
45973796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 118 - 203
Target Start/End: Original strand, 9496905 - 9496993
Alignment:
| Q |
118 |
tggatcgtattgtctccgtctgggttgcagacttgataagtcgct-gtctttatcaaagcttgatgaatcaacc--catttatgtttaa |
203 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||| ||| ||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9496905 |
tggatcgtattgtctccgtcttggttgcagacttgatgagttgctaatctttttcaaagcttgatgaatcaacccgcatttatgtttaa |
9496993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University