View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8020_low_49 (Length: 219)

Name: NF8020_low_49
Description: NF8020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8020_low_49
NF8020_low_49
[»] chr7 (1 HSPs)
chr7 (15-203)||(42292318-42292506)


Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 15 - 203
Target Start/End: Original strand, 42292318 - 42292506
Alignment:
15 cagagaggacagtttcaacattgaagcatttaggtgactcaaattacgatatgttattattaccaggagatttatcctacgcagattttttacaaaatct 114  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42292318 cagagtggacagtttcaacattgaagcatttaggtgactcaaattacgatatgttattattaccaggagatttatcctacgcagattttttacaaaatct 42292417  T
115 atgggactctttcggtcgtttggttgaaccattagcaagccaacgtccatggatggtcactacaggaaaccatgatgttgagaagattc 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42292418 atgggactctttcggtcgtttggttgaaccattagcaagccaacgtccatggatggtcactacaggaaaccatgatgttgagaagattc 42292506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University