View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8020_low_49 (Length: 219)
Name: NF8020_low_49
Description: NF8020
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8020_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 15 - 203
Target Start/End: Original strand, 42292318 - 42292506
Alignment:
| Q |
15 |
cagagaggacagtttcaacattgaagcatttaggtgactcaaattacgatatgttattattaccaggagatttatcctacgcagattttttacaaaatct |
114 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42292318 |
cagagtggacagtttcaacattgaagcatttaggtgactcaaattacgatatgttattattaccaggagatttatcctacgcagattttttacaaaatct |
42292417 |
T |
 |
| Q |
115 |
atgggactctttcggtcgtttggttgaaccattagcaagccaacgtccatggatggtcactacaggaaaccatgatgttgagaagattc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42292418 |
atgggactctttcggtcgtttggttgaaccattagcaagccaacgtccatggatggtcactacaggaaaccatgatgttgagaagattc |
42292506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University