View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8021_low_6 (Length: 275)
Name: NF8021_low_6
Description: NF8021
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8021_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 9 - 259
Target Start/End: Complemental strand, 7384646 - 7384397
Alignment:
| Q |
9 |
gaagaatattatttataggagacttatatccgttgtcaacatgcaagttcaaagttgatcataggctacttaatatgattattattaccattgtacttgc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7384646 |
gaagaatattatttataggagacttatatccgttgtcaacatgcaagttcaaagttgatcataggctacttaatatgattattattaccattgtacttgc |
7384547 |
T |
 |
| Q |
109 |
aaactcctctattggtcatcgtacacgtggcatagttgtagtttgaattccatgttacaaagagtagacgtggcaatgtccaattaaacttgagaaattg |
208 |
Q |
| |
|
|| || ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7384546 |
aagcttctctattggtcatcgtacacgtggcatagttgtagtttgtattccatgttacaaagattagacgtggcaatgtccaattaaacttgagaaattg |
7384447 |
T |
 |
| Q |
209 |
tcttatggcaaaaatactaagctaagtattcagatgatttatgttaaaaaa |
259 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||| |||||||||||| |
|
|
| T |
7384446 |
tcttatggcaaaaatactaagc-aagtattcagacgatatatgttaaaaaa |
7384397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University