View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8023_low_19 (Length: 287)
Name: NF8023_low_19
Description: NF8023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8023_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 15 - 274
Target Start/End: Complemental strand, 22251456 - 22251197
Alignment:
| Q |
15 |
atggacatcggtggaggaaggtcaccaccttctcccttcttagggggagtcttaaacttttgggagcctggagacatcctcacaggcctcaatggtgtat |
114 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22251456 |
atggacataggtggaggaaggtcaccaccttctcccttcttagggggagtcttaaacttttgggagcctggagacatcctcacaggcctcaatggtgtat |
22251357 |
T |
|
| Q |
115 |
gtcttttaattccagagttactagccgatcctgtaactgtactagggctcgctattccaaaaccaggaaccgaaggtggtggagtagacagcttccctgc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22251356 |
gtcttttaattccagagttactagccgatcctgtaactgtactagggcttgctattccaaaaccaggaaccgaaggtggtggagtagacagcttccctgc |
22251257 |
T |
|
| Q |
215 |
agattcacttattctttcgtctacttcagctaaaaactgttccagctcttcctctgatgt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22251256 |
agattcacttattctttcgtctacttcagctaaaaactgttccagctcttcctctgatgt |
22251197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University