View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8024_low_10 (Length: 248)
Name: NF8024_low_10
Description: NF8024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8024_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 18043001 - 18042771
Alignment:
| Q |
1 |
tttaataaaaccaacatgagacttgtatctaaaaaacaacacaatacatatgaaagcatgtaatgcattggtttttaactcacataacgtgtaggatttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18043001 |
tttaataaaaccaacatgagacttgtatctagaaaacaacacaatacatatgaaagcatgtaatgcatcggtttttaactcacataacgtgtaggatttg |
18042902 |
T |
|
| Q |
101 |
gatcctctcctataatgcagcggtgcagcaaattcttagnnnnnnnnnctctcactaaaaacgaatttgctgcattttgcatgtgggagagaggattcaa |
200 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
18042901 |
gatcctcccctataatgcagccgtgcagcaaattcttagtttttttttctctcactaaaaatgaatttgctgcattttacatgtgggagagatgattcaa |
18042802 |
T |
|
| Q |
201 |
attctattttggtaggatatagtcacggaag |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18042801 |
attctattttggtaggatatagtcacggaag |
18042771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 170 - 228
Target Start/End: Complemental strand, 18037816 - 18037758
Alignment:
| Q |
170 |
ctgcattttgcatgtgggagagaggattcaaattctattttggtaggatatagtcacgg |
228 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
18037816 |
ctgcattttgaatgtgggagagaggattcaaattctattttgttaggatgtagtcacgg |
18037758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University