View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8024_low_6 (Length: 398)
Name: NF8024_low_6
Description: NF8024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8024_low_6 |
 |  |
|
| [»] scaffold0082 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0082 (Bit Score: 392; Significance: 0; HSPs: 1)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 6 - 397
Target Start/End: Original strand, 51855 - 52246
Alignment:
| Q |
6 |
ttcgtgttccagaatgggcagctaaagccttttatttgcctttcatgacgatgaatgaatagtcttctccctctgatcatgatcatggcttgcttaccgg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51855 |
ttcgtgttccagaatgggcagctaaagccttttatttgcctttcatgacgatgaatgaatagtcttctccctctgatcatgatcatggcttgcttaccgg |
51954 |
T |
 |
| Q |
106 |
gacttcacttttcccttggttggatggaagtagcctcgtctcgtggcgccggtatcgaccatcgcacgagcagagtggccatttcattcagcactatctc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51955 |
gacttcacttttcccttggttggatggaagtagcctcgtctcgtggcgccggtatcgaccatcgcacgagcagagtggccatttcattcagcactatctc |
52054 |
T |
 |
| Q |
206 |
aacatacataagcccagcagacgtaggcttctaatgggtgatcgcattccgcaactgtaacggattcaccctaggggttcttccctcttgtcctcggcaa |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52055 |
aacatacataagcccagcagacgtaggcttctaatgggtgatcgcattccgcaactgtaacggattcaccctaggggttcttccctcttgtcctcggcaa |
52154 |
T |
 |
| Q |
306 |
ccagcaagtttctccttcatcggacaatctcgtgcctgaggaggactcttacaaatgaaagagccagagtccgccttagaaggccttctttg |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52155 |
ccagcaagtttctccttcatcggacaatctcgtgcctgaggaggactcttacaaatgaaagagccagagtccgccttagaaggccttctttg |
52246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University