View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8024_low_7 (Length: 360)
Name: NF8024_low_7
Description: NF8024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8024_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 5e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 233 - 341
Target Start/End: Complemental strand, 13908920 - 13908812
Alignment:
| Q |
233 |
actatgttattatgatgtgtagggcctaccaaagactcctccatgagtggtttcaagtattttgcgactttcaccaattatttttcttgcaaagtttggg |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13908920 |
actatgttattatgatgtgtagggcctaccaaagactcatccatgagtggtttcaagtattttgcgactttcaccaattatttttcttgcaaagtttggg |
13908821 |
T |
|
| Q |
333 |
tgtcccctt |
341 |
Q |
| |
|
||| ||||| |
|
|
| T |
13908820 |
tgttccctt |
13908812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 215
Target Start/End: Complemental strand, 16234409 - 16234380
Alignment:
| Q |
186 |
tatggtttaaaagtgtgtccatgaatcttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16234409 |
tatggtttaaaagtgtgtccatgaatcttt |
16234380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 175 - 215
Target Start/End: Complemental strand, 48653938 - 48653898
Alignment:
| Q |
175 |
gtgtatggatgtatggtttaaaagtgtgtccatgaatcttt |
215 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||||||| |
|
|
| T |
48653938 |
gtgtataggtgtatggtttagaagtgtgtccatgaatcttt |
48653898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 175 - 215
Target Start/End: Complemental strand, 27915607 - 27915567
Alignment:
| Q |
175 |
gtgtatggatgtatggtttaaaagtgtgtccatgaatcttt |
215 |
Q |
| |
|
|||||| | ||||||||||| |||||||||||||||||||| |
|
|
| T |
27915607 |
gtgtataggtgtatggtttagaagtgtgtccatgaatcttt |
27915567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University