View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8024_low_9 (Length: 300)
Name: NF8024_low_9
Description: NF8024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8024_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 58 - 199
Target Start/End: Complemental strand, 6448570 - 6448430
Alignment:
| Q |
58 |
tagtttattatgtttcttaaatttctccacaaacggtatcttcctacattgatagacttattatctcagaatacccccattctctattgttgatgaaaat |
157 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6448570 |
tagtttattatgtttcttaaatttctccgcaaacggtatcttcctacattgatagacttattatctcagaata-ccccattctctattgttgatgaaaat |
6448472 |
T |
|
| Q |
158 |
catactttattatttatcattgaaacctaagaatttcacgaa |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
6448471 |
catactttattatttatcattgtaacctaagagtttcacgaa |
6448430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 198 - 278
Target Start/End: Complemental strand, 6448385 - 6448304
Alignment:
| Q |
198 |
aaacaaattttatataaaatcccaaattcacagatatgtaatttagccattgttatta-cttatgtttttaaaaccttatta |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6448385 |
aaacaaattttatataaaatcccaaattcatagatatgtaatttagccattgttattatcttatgtttttaaaaccttatta |
6448304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University