View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8025_high_5 (Length: 229)
Name: NF8025_high_5
Description: NF8025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8025_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 213
Target Start/End: Original strand, 9167965 - 9168163
Alignment:
| Q |
15 |
atccatcaaaaaatgcacctcgcaaaccttaacagaaaaaagatattgaaaaattcaatgaacgtgatcgtactcgaatcaaacgagtgagggtggtgcc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9167965 |
atccatcaaaaaatgcacctcgcaaaccttaacagaaaaaagatattgaaaaattcaatgaacgtgatcgtactcgaatcaaacgagtgagggtggtgcc |
9168064 |
T |
|
| Q |
115 |
acaggtggagcatttagagcgatttttcgccatggttttgccgcaggttgaacaaagagtcatgtgcttgcaattgcttccgtagagacaggtggttac |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
9168065 |
acaggtggagcatttagagcgatttttcgccatggttttgccgcaggttgaacaaagagtcatgtgcttgcaattgcttccgtagagaccggtggttac |
9168163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 85 - 211
Target Start/End: Original strand, 9156378 - 9156504
Alignment:
| Q |
85 |
tactcgaatcaaacgagtgagggtggtgccacaggtggagcatttagagcgatttttcgccatggttttgccgcaggttgaacaaagagtcatgtgcttg |
184 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||||||||||| |||| | |||| ||||| ||||||| |
|
|
| T |
9156378 |
tactcgaatcaaacgagtgagcaacgcgccacaggtggagcatttagagcgattttccgccatggttttgccacagggggcgcaaatagtcaagtgcttg |
9156477 |
T |
|
| Q |
185 |
caattgcttccgtagagacaggtggtt |
211 |
Q |
| |
|
||||||||||||||||||| ||||||| |
|
|
| T |
9156478 |
caattgcttccgtagagaccggtggtt |
9156504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University