View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8026_high_18 (Length: 247)
Name: NF8026_high_18
Description: NF8026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8026_high_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 60 - 234
Target Start/End: Complemental strand, 17885506 - 17885332
Alignment:
| Q |
60 |
ctttcgcattttgaatttctaggtttcttcttcctgcattatccatgctgagagcttcatctaaatccgtccaaccacacggtcatcataccggagttcg |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17885506 |
ctttcgcattttgaatttctaggtttcttcttcctgcattatccatgctgagagcttcatctaaatccgtccaaccacacggtcatcataccggagttcg |
17885407 |
T |
 |
| Q |
160 |
tatcattgttgccggagaaaaatgtactggtaaatccaccctcattcgcgctgcggcctccaacaaatttgagaa |
234 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17885406 |
tatcgttgttgccggagaaaaatgtaccggtaaatccaccctcattcgcgctgcggcctccaacaaatttgagaa |
17885332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 17885566 - 17885527
Alignment:
| Q |
20 |
taaactccttcgtcttttcactccaacgcaatttcaccct |
59 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17885566 |
taaagtccttcgtcttttcactccaacgcaatttcaccct |
17885527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University