View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8026_low_14 (Length: 278)
Name: NF8026_low_14
Description: NF8026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8026_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 126 - 264
Target Start/End: Complemental strand, 53609154 - 53609013
Alignment:
| Q |
126 |
caaccttagctgggaatgcaggactagttgctgccttaatttccttaacaagcacaagcactataggtagtggttttgacactg---ataccattttcaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53609154 |
caaccttagctgggaatgcaggactagttgctgccttaatttccttaacaagcacaagcactataggtagtggttttgacactgatcataccattttcaa |
53609055 |
T |
 |
| Q |
223 |
tcaaactcgacaatacagaccacaaaatctacctccaccata |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53609054 |
tcaaactcgacaatacagaccacaaaatctacctccaccata |
53609013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 16 - 119
Target Start/End: Complemental strand, 53610460 - 53610356
Alignment:
| Q |
16 |
attgtcaagggagctgaaactgtctttgcatttgcaagagactctagtaaaagggcaccctacagtagtggataacc-ttacattgaaccttatattata |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |||| ||| |
|
|
| T |
53610460 |
attgtcaagggagctgaaactgtctttgcatttgcaagagactctagtaaaagggcaccctacagtagtggacaacctttacattgaacctaatataata |
53610361 |
T |
 |
| Q |
115 |
actca |
119 |
Q |
| |
|
||||| |
|
|
| T |
53610360 |
actca |
53610356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 126 - 182
Target Start/End: Complemental strand, 37210502 - 37210446
Alignment:
| Q |
126 |
caaccttagctgggaatgcaggactagttgctgccttaatttccttaacaagcacaa |
182 |
Q |
| |
|
|||| |||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37210502 |
caactttagctggaaatgcaggactagtagctgccttaatttccttaacaagcacaa |
37210446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 19 - 104
Target Start/End: Complemental strand, 37211865 - 37211780
Alignment:
| Q |
19 |
gtcaagggagctgaaactgtctttgcatttgcaagagactctagtaaaagggcaccctacagtagtggataaccttacattgaacc |
104 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| | ||||||| || | |||||| | ||| | |||||||||||||| |
|
|
| T |
37211865 |
gtcaagggagctgaaactgcctttgcatttgcaagagactttggtaaaagatcaacatacagtcgcggaaagccttacattgaacc |
37211780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University