View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8026_low_19 (Length: 251)
Name: NF8026_low_19
Description: NF8026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8026_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 13 - 145
Target Start/End: Complemental strand, 3105291 - 3105158
Alignment:
| Q |
13 |
aatatcttctatgtttaacacaaagtaaagtactttccttttcaacccta-------tgaactctatctatctatatagtctttcaccttttctcatacc |
105 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3105291 |
aatatcttctatgtttaacacaaagta-----ctttccttttcaaccctactctctatga-ctctatctatctatatagtcttttaccttttctcatacc |
3105198 |
T |
|
| Q |
106 |
ttacctctttgttcctctgtctcctactctgttacgagtt |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3105197 |
ttacctctttgttcctctgtctcctactctgttacgagtt |
3105158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University