View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8026_low_9 (Length: 353)
Name: NF8026_low_9
Description: NF8026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8026_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 15 - 337
Target Start/End: Original strand, 37620232 - 37620543
Alignment:
| Q |
15 |
aacctgtgctaaattggaaaatgcactcataatttatgtcttttatatttattaattttggccagtaaacgaagtagcgagcaccatctgaaactcacac |
114 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37620232 |
aacctgtgctaaattgaaaaatgcactcataattaatgtcttttatatttattaattga------------aagtagcgagcaccatctgaaactcacac |
37620319 |
T |
 |
| Q |
115 |
atacaactatgaggttgggttcgaattcttgtgaaagtatccagcatagcaatatagacattgctagtcgagctagactttaccatctttcttttatatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37620320 |
atacaactatgaggttgggttcgaattcttgtgaaagtatccagcatagcaatatagacattgctagtcgagctagactttaccatctttcttttatatt |
37620419 |
T |
 |
| Q |
215 |
ttcaaattttgtcgaaataattaactttcggaatgttatgctttgaaggaaagtgcagaaatttgatcaattctatcaat-agaggagagtctggaaatg |
313 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37620420 |
ttcaacttttgtcgaaataattaactttcggaatgttatgttttgaaggaaagtgcagaaatttgatcaattctatcaataagaggagagtctggaaatg |
37620519 |
T |
 |
| Q |
314 |
aaaaggtgtgtttgcttttctttt |
337 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37620520 |
aaaaggtgtgtttgcttttctttt |
37620543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University